The dialyzed fraction containing the His 6 -LytT protein was further loaded onto a 1 ml Hitrap heparin column (GE) to remove contaminants (Text S1). The P pftAB DNA substrate for His 6 -CcpA and His 6 -LytT was PCR amplified from strain BSB168 using Cy5-labeled primers (P1, CCATGGTTTAATTCAACGTATAATC; P2, CGTACACTTTTTTAGCACTCATTTTCTTCACC) while the P pftAB-?lytT1, Samples eluted with 50 mM Tris-HCl (pH 8.0), 1 M NaCl, and 250 mM imidazole were dialyzed against a solution containing 50 mM Tris-HCl (pH 8.0), 0.4 M NaCl, 50% glycerol, 1 mM dithiothreitol (DTT) ,
, For EMSAs with His 6 -LytT, 50 ng of DNA substrate was used with 50 g · ml ?1 of nonspecific competitor poly
, 10 ng of DNA substrate was used with 400 g · ml ?1 sheared salmon sperm DNA competitor. Samples were loaded onto a 6% or 8% acrylamide (19:1) native gel in Tris-acetate-EDTA (TAE), migration was carried out at 20 V · cm ?1 and imaged on a ChemiDoc imaging system, CcpA protein was mixed with the serine-phosphorylated HPr (kind gift of Josef Deutscher) in a 1:10 molar ratio
, The role of root exudates in rhizosphere interactions with plants and other organisms, 2006.
, Annu Rev Plant Biol, vol.57, pp.233-266
Aluminum-resistant Arabidopsis mutants that exhibit altered patterns of aluminum accumulation and organic acid release from roots, Plant Physiol, vol.117, pp.9-18, 1998. ,
Root-secreted malic acid recruits beneficial soil bacteria, Plant Physiol, vol.148, pp.1547-1556, 2008. ,
Bacillus subtilis early colonization of Arabidopsis thaliana roots involves multiple chemotaxis receptors, vol.7, pp.1664-1680, 2016. ,
Isolated Bacillus subtilis strain 330-2 and its antagonistic genes identified by the removing PCR, Sci Rep, vol.7, p.1777, 2017. ,
The Bacillus subtilis YufLM two-component system regulates the expression of the malate transporters MaeN (YufR) and YflS, and is essential for utilization of malate in minimal medium, Microbiology, vol.149, pp.2317-2329, 2003. ,
Transcriptional regulation is insufficient to explain substrate-induced flux changes in Bacillus subtilis, Mol Syst Biol, vol.9, 2013. ,
URL : https://hal.archives-ouvertes.fr/hal-01204283
Regulation of the rhaE-WRBMA operon involved in L-rhamnose catabolism through two transcriptional factors, RhaR and CcpA, in Bacillus subtilis, J Bacteriol, vol.198, pp.830-845, 2015. ,
Plant cell wall degradation by saprophytic Bacillus subtilis strains: gene clusters responsible for rhamnogalacturonan depolymerization, Appl Environ Microbiol, vol.73, pp.3803-3813, 2007. ,
Role of the ganSPQAB operon in degradation of galactan by Bacillus subtilis, J Bacteriol, vol.198, pp.2887-2896, 2016. ,
From a consortium sequence to a unified sequence: the Bacillus subtilis 168 reference genome a decade later, Microbiology, vol.155, pp.1758-1775, 2009. ,
Metabolic fluxes during strong carbon catabolite repression by malate in Bacillus subtilis, J Biol Chem, vol.285, pp.1587-1596, 2010. ,
Malate-mediated carbon catabolite repression in Bacillus subtilis involves the HPrK/CcpA pathway, J Bacteriol, vol.193, pp.6939-6949, 2011. ,
URL : https://hal.archives-ouvertes.fr/hal-01019483
Identification and functional expression of the mitochondrial pyruvate carrier, Science, vol.337, pp.93-96, 2012. ,
A mitochondrial pyruvate carrier required for pyruvate uptake in yeast, Drosophila, and humans, Science, vol.337, pp.96-100, 2012. ,
Identification and characterization of a bacterial transport system for the uptake of pyruvate, propionate, and acetate in Corynebacterium glutamicum, J Bacteriol, vol.191, pp.940-948, 2009. ,
A monocarboxylate permease of Rhizobium leguminosarum is the first member of a new subfamily of transporters, J Bacteriol, vol.184, pp.5436-5448, 2002. ,
The complete genome sequence of the Gram-positive bacterium Bacillus subtilis, Environ Microbiol, vol.390, pp.83-94, 1997. ,
Condition-dependent transcriptome reveals high-level regulatory architecture in Bacillus subtilis, Science, vol.335, pp.1103-1106, 2012. ,
URL : https://hal.archives-ouvertes.fr/hal-01000245
Ecology and genomics of Bacillus subtilis, Trends Microbiol, vol.16, pp.269-275, 2008. ,
Global network reorganization during dynamic adaptations of Bacillus subtilis metabolism, Science, vol.335, pp.1099-1103, 2012. ,
URL : https://hal.archives-ouvertes.fr/hal-01000240
Essential Bacillus subtilis genes, Proc Natl Acad Sci U S A, vol.100, pp.4678-4683, 2003. ,
Building the repertoire of dispensable chromosome regions in Bacillus subtilis entails major refinement of cognate large-scale metabolic model, Nucleic Acids Res, vol.41, pp.687-699, 2013. ,
URL : https://hal.archives-ouvertes.fr/hal-01190671
Large-scale reduction of the Bacillus subtilis genome: consequences for the transcriptional network, resource allocation, and metabolism, Genome Res, vol.27, pp.289-299, 2017. ,
URL : https://hal.archives-ouvertes.fr/hal-02626760
Rational improvement of the engineered isobutanol-producing Bacillus subtilis by elementary mode analysis, Microb Cell Fact, vol.11, p.101, 2012. ,
Genomic reconstruction of the transcriptional regulatory network in Bacillus subtilis, J Bacteriol, vol.195, pp.2463-2473, 2013. ,
The Bacillus subtilis ywkA gene encodes a malic enzyme and its transcription is activated by the YufL/YufM twocomponent system in response to malate, Microbiology, vol.149, pp.2331-2343, 2003. ,
YtsJ has the major physiological role of the four paralogous malic enzyme isoforms in Bacillus subtilis, J Bacteriol, vol.188, pp.167-173, 2006. ,
URL : https://hal.archives-ouvertes.fr/hal-00164221
Acetic acid acts as a volatile signal to stimulate bacterial biofilm formation. mBio 6:e00392, 2015. ,
The control of death and lysis in staphylococcal biofilms: a coordination of physiological signals, Curr Opin Microbiol, vol.15, pp.211-215, 2012. ,
PLGG1, a plastidic glycolate glycerate transporter, is required for photorespiration and defines a unique class of metabolite transporters, Proc Natl Acad Sci U S A, vol.110, pp.3185-3190, 2013. ,
A chloroplast envelope membrane protein containing a putative LrgB domain related to the control of bacterial death and lysis is required for chloroplast development in Arabidopsis thaliana, New Phytol, vol.193, pp.81-95, 2012. ,
Impact of the Staphylococcus epidermidis LytSR two-component regulatory system on murein hydrolase activity, pyruvate utilization and global transcriptional profile, BMC Microbiol, vol.10, p.287, 2010. ,
Identification of a target gene and activating stimulus for the YpdA/YpdB histidine kinase/response regulator system in Escherichia coli, J Bacteriol, vol.195, pp.807-815, 2013. ,
Identification of a novel nutrient-sensing histidine kinase/response regulator network in Escherichia coli, J Bacteriol, vol.196, pp.2023-2029, 2014. ,
The acetate switch, Microbiol Mol Biol Rev, vol.69, pp.12-50, 2005. ,
Stochastic simulation of prokaryotic two-component signalling indicates stochasticityinduced active-state locking and growth-rate dependent bistability, Mol Biosyst, vol.10, pp.2338-2346, 2014. ,
Molecular cloning: a laboratory manual, 1989. ,
Chemically defined growth media and supplements, p 548, Molecular biological methods for Bacillus, 1990. ,
Transcriptional profiling of gene expression in response to glucose in Bacillus subtilis: regulation of the central metabolic pathways, Metab Eng, vol.5, pp.133-149, 2003. ,
Plasmids for ectopic integration in Bacillus subtilis, Gene, vol.180, issue.96, pp.404-404, 1996. ,
pBaSysBioII: an integrative plasmid generating gfp transcriptional fusions for high-throughput analysis of gene expression in Bacillus subtilis, Microbiology, vol.156, pp.1600-1608, 2010. ,
CcpN (YqzB), a novel regulator for CcpA-independent catabolite repression of Bacillus subtilis gluconeogenic genes, Mol Microbiol, vol.55, pp.1435-1451, 2005. ,
Easy cloning of mini-Tn10 insertions from the Bacillus subtilis chromosome, J Bacteriol, vol.176, pp.1761-1763, 1994. ,
Small subunits of RNA polymerase: localization, levels and implications for core enzyme composition, Microbiology, vol.156, pp.3532-3543, 2010. ,
The dynamic protein partnership of RNA polymerase in Bacillus subtilis, Proteomics, vol.11, pp.2992-3001, 2011. ,
URL : https://hal.archives-ouvertes.fr/hal-01000647
MreB-dependent inhibition of cell elongation during the escape from competence in Bacillus subtilis, PLoS Genet, vol.11, 2015. ,
URL : https://hal.archives-ouvertes.fr/hal-02631205