Skip to Main content Skip to Navigation
Journal articles

Involvement of Cis-acting elements in molecular regulation of JH-mediated vitellogenin gene 2 of female Periplaneta americana

Abstract : Vitellogenins (Vgs) are yolk protein precursors that are regulated by juvenile hormone (JH) and/or 20-hydroxyecdysone (20E) in insects. JH acts as the principal gonadotropin that stimulates vitellogenesis in hemimetabolous insects. In this study, we cloned and characterized the Periplaneta americana Vitellogenin 2 ( Vg2 ) promoter. Multiple sites for putative transcription factor binding were predicted for the 1,804 bp Vg2 promoter region, such as the Broad-Complex, ecdysone response element (EcRE), GATA, Hairy, JH response element (JHRE), and Methoprene (Met)-binding motif, among others. Luciferase reporter assay has identified that construct −177 bp is enough to support JH III induction but not 20E suppression. This 38 bp region (from −177 to −139 bp) contains two conserved response element half-sites separated by 2 nucleotides spacer (DR2) and is designated as Vg2 RE ( −168 GAGTCACGGAGTCGCCGCTG −149 ). Mutation assay and luciferase assay data using mutated constructs verified the crucial role of G residues in Vg2 RE for binding the isolated fat body nuclear protein. In Sf 9 cells, a luciferase reporter placed under the control of a minimal promoter containing Vg2 RE was induced by JH III in a dose- and time-dependent manner. Nuclear proteins isolated from previtellogenic female fat body cells bound to Vg2 RE, and this binding was outcompeted by a 50-fold excess of cold Drosophila melanogaster DR4 and Galleria mellonella JH binding protein response elements (Chorion factor-I/Ultraspiracle). Affinity pull-down experiment with nuclear extracts of previtellogenic female fat body, using 31-bp probe Vg2 RE as bait, yielded a 71 kDa candidate nuclear protein that may mediate the regulatory action of the JH III.
Document type :
Journal articles
Complete list of metadata

https://hal.inrae.fr/hal-03335815
Contributor : Bernard DUVIC Connect in order to contact the contributor
Submitted on : Wednesday, November 10, 2021 - 11:36:54 AM
Last modification on : Friday, August 5, 2022 - 10:57:09 AM
Long-term archiving on: : Friday, February 11, 2022 - 6:34:41 PM

File

fphys-12-723072.pdf
Publisher files allowed on an open archive

Licence


Distributed under a Creative Commons Attribution 4.0 International License

Identifiers

Citation

Azza M Elgendy, Amr A Mohamed, Bernard Duvic, Muhammad Tufail, Makio Takeda. Involvement of Cis-acting elements in molecular regulation of JH-mediated vitellogenin gene 2 of female Periplaneta americana. Frontiers in Physiology, Frontiers, 2021, 12, ⟨10.3389/fphys.2021.723072⟩. ⟨hal-03335815⟩

Share

Metrics

Record views

44

Files downloads

41